GD 2 ganglioside on human T - lymphotropic virus type I - infected T cells : Possible activation of , B - 1 , 4 - N - acetylgalactosaminyltransferase gene by p 4
نویسنده
چکیده
Ganglioside expression on adult T-cell leukemia (ATL) and human T-cell lymphotropic virus type I (HTLVI)-infected cells was determined by using a panel ofmonoclonal antibodies. ATL lines and HTLV-I-infected cells specifically expressed GD2. Leukemia cells from ATL patients generally expressed low levels of GD2 but the percentage of GD2+ cells increased up to 40-70% after in vitro culture in the presence of interleukin 2 for about a week. No other type of leukemia cells and normal peripheral T cells expressed GD2 during in vitro culture under the same conditions. The appearance of GD2 in the cultured ATL cells corresponded with the expression of p40", a product of the HTLV-I gene. Peripheral lymphocytes infected with a p40W-expressing retroviral vector expressed high levels of GD2 in comparison with control lymphocytes containing the neomycin-resistance gene alone. The apparently increased levels of 13-1,4-N-acetylgalactosaminyltransferase (GM2/GD2 synthase) mRNA in these cells were demonstrated by reverse transcription-polymerase chain reaction analysis. Concordance between mRNA expression for the HTLV-I taxl/rexl genes and the 3-1,4-N-acetylgalactmyltrans ferase gene was also observed in uncultured ATL cells. These results suggest that high GD2 expression was due to neosynthesis from precursor GD3 by increased expression of this enzyme induced by p40t in vito and in vivo. Dramatic changes in carbohydrate composition and metabolism have been observed in association with cellular differentiation, development, viral infection, and malignant transformation (1, 2). These carbohydrate structures characteristic of a particular cellular population can be generally classified into two types: (i) those arising from incomplete synthesis of normally existing carbohydrate chains and (ii) those arising from neosynthesis through activation of glycosyltransferases. Studies of glycolipids in human leukemia cells have revealed the formation of tumor-associated carbohydrate markers characteristic of each specific type of leukemia. Globotriaosyl ceramide (Gb3) expression in Burkitt lymphoma has been described (3, 4). Specific expression ofGD3 in myeloid and lymphoid leukemia cells was also reported (6, 7). Two retroviruses that infect mainly leukocytes of human origin have been isolated and characterized in detail. One is the human immunodeficiency virus (HIV-1), which causes AIDS. Adachi et al. (8) reported the specific expression of Ley antigen in a human T-cell line and peripheral lymphocytes infected with HIV. The other retrovirus is human T-cell lymphotropic virus type I (HTLV-I), which causes malignant transformation of T lymphocytes, resulting in adult T-cell leukemia (ATL) (9). No extensive studies on the expression of specific carbohydrate antigens in ATL cells and HTLVI-positive (HTLV-I+) cells have been reported although there are a few studies of a small number ofATL patients (10, 11). In this study, we showed that the GD2 ganglioside was highly and specifically expressed in HTLV-I+ cells and ATL cells. Significant levels ofGD2 were not detected in any other type of leukemia or normal lymphocyte, indicating the relationship between GD2 and HTLV-I infection. Our analysis on p40a-expressing T cells and leukemia cells from ATL patients suggests that the HTLV-I p40" protein can induce the synthesis of GD2 through the activation of GM2/GD2 synthase. MATERIALS AND METHODS Cells and Cell Lines. HTLV-I-infected human T-cell lines used in this study include the interleukin 2 (IL-2)-independent lines HUT102 (9), MT-2 and MT-1 (12), TL-Su (13), and ATN-1 (14); and the IL-2-dependent lines Oka2, Oka3, Kaw2, Kaw3, 4070, Deg, Kih, Ish, and Ike. All lines were established from ATL patients except 4070 and Deg. 4070 was from peripheral blood mononuclear cells (PBMCs) of a HTLV-I carrier, and Deg was from a normal individual by coculture with TL-Su. All cell lines were CD4+ except Kih, which was CD8+. Monoclonal Antibodies (mAbs). mAbs used in this study were as follows: anti-GD2 ganglioside, mAb 3F8 (mouse IgG3) (15); anti-GD3, mAb R24 (mouse IgG3) (16); anti-GM2, mAb 10-11 (mouse IgM) (17); anti-GM3, mAb M2590 (mouse IgM) (Meiji Seika, Tokyo) (18); anti-HTLV-I env, mAb REY-7 (rat IgG) (19); anti-HTLV-I p40w, mAb Lt4 (mouse IgG) (20); anti-CD4, OKT4; anti-CD8, OKT8; and anti-CD3, OKT3 (the last three mAbs were obtained from American Type Culture Collection). Serological Analysis. The expression of antigens on leukemia cells, leukemic cell lines, and lymphocytes was measured by flow cytometry (FCM) using a FACScan (Becton Dickinson). Abbreviations: HTLV-I, human T-celi lymphotropic virus type I; ATL, adult T-cell leukemia; ALL, acute lymphoblastic leukemia; IL, interleukin; r, recombinant; mAb, monoclonal antibody; RT-PCR, reverse transcription-polymerase chain reaction; GaINAc-T, P-1,4N-acetylgalactosaminyltransferase; PBMC, peripheral blood mononuclear cell; FCM, flow cytometry; PBL, peripheral blood lymphocyte; neo, neomycin resistance. ITo whom reprint requests should be addressed. Gangliosides are designated according to the nomenclature of Svennerholm (5). 1972 The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Medical Sciences: Furukawa et al. For immunofluorescence assay of p40", mAb Lt4 and fluorescein isothiocyanate-labeled second antibody were used. Western Blot Analysis. The p40a protein was detected by Western blot analysis by the method of Towbin et al. (21). The poly(vinylidene difluoride) membrane (Immobilon; Millipore) with transferred proteins was incubated with mAb Lt4 and was stained using the VectaStain ABC kit (Vector Laboratories), and then p40a was detected with the ECL detection system (Amersham). Densitometric analysis of the p40w bands was performed by using the Unigraphy UHG101 (Unique Medical, Tokyo). Introduction and Expression of p40t in Normal Peripheral Blood Lymphocytes (PBLs). p40w was expressed in normal PBLs by a retroviral vector. The construction of the p40aexpressing retroviral vector DGL-Taxl and a control vector, DGL, lacking the Taxl-coding region, has been described (22), and its schematic structure is shown in Fig. 3A. Infection ofPBLs with the retroviral vector was carried out as described (22). Briefly, normal PBLs that had been stimulated by phytohemagglutinin and expanded by addition of recombinant (r) IL-2 were infected with DGL-Taxl by cocultivation with -y-irradiated (2000 rad; 1 rad = 0.01 Gy) virus-producing cells and selected with G418. RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR). To analyze the expression of UDP-GalNAc:GM3/GD3 ,B-1,4-N-acetylgalactosaminyltransferase (GalNAc-T; EC 2.4.1.92) and HTLV-I taxl/rexl (23) mRNAs, a RT-PCR analysis was performed. We have reported (24) the cDNA cloning of the GalNAc-T gene. Total RNA was prepared and single-strand cDNA was synthesized with a (dT)14 primer as described (25). The PCR primers used for the GalNAc-T gene were a M2T-S1 sense primer (GalNAc-T cDNA clone M2T1-1, nt 142-161), 5'AGGCCCGGGCTGCCAGATCT-3', and a M2T-AS2 antisense primer (nt 677-696), 5'-GGTCTGGAAGCTTCGGCTGC-3'. RT-PCR conditions for taxl/rex) gene have been described (25). The primers used were a pX-1 sense primer, 5'-TACCTGAGGGCCCCATCCACGCCGGTTGA-3', and a pX-2 anti-sense primer, 5'-ACACAGTCTCGAGACACGTAGACTGGG TAT-3'. Southern Blot Analysis of RT-PCR Products. The RT-PCR products separated by PAGE were transferred onto nylon filters (GeneScreenPlus; DuPont). For the detection of PCR products of GalNAc-T gene, fiters were hybridized with a probe at 60°C for 15 hr. The probe was labeled with 32P by using the random-priming labeling kit (Amersham). For the detection of the taxl/rex) gene, an oligonucleotide probe, pX-PX (TCCCAGGGTTTGGACAGAGTCTT), was used as described (25).
منابع مشابه
Evaluating the frequency of HTLV-Ι/Π infection among blood donors, major thalassemic patients and individuals infected with hepatitis B and C viruses in Isfahan, Iran
Background: The human T-cell lymphotropic virus type I is the first retrovirus idenfied in humans. The virus has been associated with adult T-cell leukemia/lymphoma, human T-lymphotropic virus type I, myelopathy/tropical spasc paraparesis, uveis, arthris, pulmonary lymphocyc alveolis, keratoconjuncvis sicca, and infecous dermas. Human T-lymphotropic virus type Iis endemic in Japan...
متن کاملHuman T Lymphotropic Virus Type I (HTLV-I) Oncogenesis: Molecular Aspects of Virus and Host Interactions in Pathogenesis of Adult T cell Leukemia/Lymphoma (ATL)
The study of tumor viruses paves the way for understanding the mechanisms of virus pathogenesis, including those involved in establishing infection and dissemination in the host tumor affecting immune-compromised patients. The processes ranging from viral infection to progressing malignancy are slow and usually insufficient for establishment of transformed cells that develop cancer in only ...
متن کاملPolymorphism in the interleukin-10 promoter affects both provirus load and the risk of human t lymphotropic virus type I (HTLV-I) associated myelopathy/tropical spastic paraparesis
To investigate candidate genes that influence the risk of HTLV-I associated myelopathy/tropical spastic paraparesis (HAM/TSP), we analyzed 6 single nucleotide polymorphisms (SNP) in the interleukin-10 (IL-10) promoter region. METHODS: 280 cases of HAM/TSP patients and 255 HTLV-I seropositive asymptomatic carriers (HCs) from Kagoshima, Japan were studied. All subjects gave written informed conse...
متن کاملPolymorphism in the interleukin-10 promoter affects both provirus load and the risk of human t lymphotropic virus type I (HTLV-I) associated myelopathy/tropical spastic paraparesis
To investigate candidate genes that influence the risk of HTLV-I associated myelopathy/tropical spastic paraparesis (HAM/TSP), we analyzed 6 single nucleotide polymorphisms (SNP) in the interleukin-10 (IL-10) promoter region. METHODS: 280 cases of HAM/TSP patients and 255 HTLV-I seropositive asymptomatic carriers (HCs) from Kagoshima, Japan were studied. All subjects gave written informed conse...
متن کاملChromosome and gene rearrangements in immortalized human lymphocytes infected with human T-lymphotropic virus type I.
Karyotypes of 26 human lymphocyte cultures, infected or noninfected with human T-lymphotropic virus type I (HTLV-I), with or without Epstein-Barr virus infection, were analyzed by G-banding. Hypodiploidy and structural abnormalities were seen more frequently in HTLV-I-infected cultures (30%) than in virus noninfected cultures (10%) propagated for less than 200 days. In all of six immortalized c...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره شماره
صفحات -
تاریخ انتشار 2005